Saturday, November 9, 2019

The World Is Flat

Thomas Friedman in his recent book ‘The world is flat’ discusses a short history of globalisation in the twenty-first century. His discovering journey took him around the world to investigate the new concept in transnational business. He views himself as Columbus-like, but in a new modern word, in which he is searching for the sources of today’s wealth. Only to come to a rhetorical conclusion that the world is â€Å"flat† not round! His book, ‘The world is flat’ has been a subject to much criticism. His work was highly criticizes by Aronica and Ramdoo, (2006) in their book ‘The World is Flat? A Critical Analysis of Thomas Friedman’s New York Times Bestseller’. They point to the fact that Friedman does not use a single table or data footnote in his book. Friedman makes arguments by assertion, based on not documented facts, but makes his assumption based on stories from his journey around the world, visiting few places, and selected CEOs he visits on his journey.(Aronica & Ramdoo, 2006) Friedman in a research for his book visits India, where Nandan, the CEO of Infosys explains to him that; â€Å"the playing field is being leveled† causing Friedman to conclude that the world is flat. (Friedman, 2006 p.7) Friedman refers to a â€Å"flat world† in a metaphorical sense. He reiterates over and over again that â€Å"The world is flat†. In which he means that reducing barriers in trade and political and technical advances have made it possible to do business, instantly with any other businesses around the world, without the need to emigrate. It has allowed for parts of the world, which had previously been disconnected, like India and China, to compete in the world market. And that we are now connecting all the knowledge and expertise, using computers, email, fibre-optic networks and so on. Friedman argues that there are ten major forces that flattened the world, and describes each of the following â€Å"flatteners†. The fall of the Berlin Wall; or the work flow software; uploading; outsoursing; offshoring; insourcing; in-forming; and lastly he talks about steroids. Next Friedman delve into what he describes that the forces of flatness have resulted in â€Å"the triple convergence,† three additional components that acted on the flatteners to create a new, flatter global playing field. Friedman also states that â€Å"technology has made the world flat by removing geographical, hierarchical and other boundaries to trade†. In a flat world, Friedman writes, â€Å"you can innovate without having to emigrate. Yet, there are still many people in rural areas that have been left out and neglected of this global integration. People are migrating from rural areas to the big cities in search of jobs all the time, and this is what Friedman calls a ‘flat world’? Richard Florida,(2005) in his article ‘The World is spiky’ argues that â€Å"the globalisation has changed the playing field but it has not leveled it.†, Richard talks about â€Å"uneven distribution of the world’s population, light emissions, focusing on ‘peaks’ as of the cities that drive the world economy, and ‘valleys’ – places with little connection to the global economy.† Both authors seems to be right, but they both missing the point, using misleading metaphors. The paradox of these two metaphors is that the flattening of the world is creating a new prospect for even greater spikiness. Some would argue that it does not matter whether the world is spiky or flat. What does matter is where you live. Now, people have to compete and work harder than ever before. People in American are losing their jobs because someone on the other side of the world can do it faster and for less money. Technology makes it all more possible today to bring the world closer and make it more interconnected and interdependent.(Friedman, 2006) However, technological innovation by itself will never flatten the world, instead it tends to create inequalities by being inaccessible to less fortunate. Leamer (2007) in his critical review demonstrate that the technological revolution, economic integration and interaction increase the openness of trade and promote the production and transmission of information and knowledge in general. However, it is possible that increasing economic integration can lead to spatial agglomeration of economic activity rather than to a geographically ‘flatten pattern†. Process of globalization may as well wipe out space and distance between countries, then again, some will argue that in a global economy, competitive advantages are often heavily localized, arising from concentrations of highly specialised skills, knowledge and institutions. Friedman argues, that the world is getting flatter, incomes though, are not. Distribution of incomes within countries and between countries is growing greater. Nevertheless, all these arguments show that the world is not flat, never was and is not likely going to be in the near future. In second chapter, Friedman describes than Netscape went public and how Internet and World Wide Web came along and enabled more people to communicate and interact with more people anywhere on the planet, causing the Earth to flatten even more. In 2007 Foreign Policy magazine article, Pankaj Ghemawa, argued that ninety percent of the world’s web traffic, investments and phone calls are local, suggesting that Friedman has overstated the significance of the trends he describes. (Ghemawat, P. 2007). Friedman talks about ‘outsourcing’ of manufacturing and other processes to a foreign country to take advantage of less-costly labour. Outsourcing may indeed be good for the multinational corporations to stay competitive and survive, however, Arnica and Ramdoo (2006) in their book argue that, Friedman discuss in a favor of global corporations moving their operations overseas to exploit weak governments and cheap labor. Global corporations are not invested in the well-being of American workers and their local communities. Instead they go wherever they can to exploit cheap labor, lax environmental regulations and tax breaks. Stiglitz (2006) in his book points out that, the policy frameworks and laws are manipulated to be best suited for the industrial elites. Moving operations overseas is â€Å"cost cutting† to improve the financial performance of big corporations, without loyalty to one’s country. Their only loyalty is to increased profits and increased salaries of their directors. As a result of outsourcing, Many of American citizens, according to Friedman, are now worried about their careers, because some of the jobs they used to hold are now being performed outside the country for a much lower cost to their former companies. The reason behind the outsourcing is simply the cost. Indian workers can work for far less then American. The question is what will be the outcome of shipping all these jobs overseas? Some will argue that outsourcing less skilled work to emerging economies will raise living standards around the world. Workers in developing nations will get new and higher- paying jobs, and consumers in the U.S will be able to buy products that are cheaper than if they were made at home. Leamer (2007) argues that â€Å"it makes both parties worse off† saying â€Å"we get their wages and they get our culture. Outsourcing is occurring at a breathtaking pace, and as a result America is facing a big challenge because their jobs are at risk. Business services and finance is now at risk of being outsourced. And in the near future accounts, marketing and sales, and even human recourses will be shipped overseas in the name of cost saving. We are not only outsourcing business processes, but also moving process of innovations. Overall, this is good for global economy, but the U.S. workforce will face drastic career changes and pressures on wages subject to competition from foreign labor. Thus, what is good for some might not be good for others. Another example given by Mr. Friedman that stroked me is how Southwest Airlines let you issue your own boarding pass online twenty-four hours before the flight. What if you forget to print out your ticket? This is just a simple demonstration of declining quality of services a customer receives in a flatten world. I would argue that while the flat world has done extremely well for many industries and people around the world, Friedman but does not realized that the more flatten world brings many dark sides of globalisation along with it. The global financial system is more unbalanced, the threats of climate change are stronger and there is more international terrorism. The Friedman is reinforcing a wrong message to its audience for peace, loyalty and prosperity. Thomas Friedman points out that different parts of the world are now more connected because convergence of technology, information systems and telecommunications systems that created a ‘global platform’ is shrinking the world, and enabling each of us to reach around the world faster and cheaper than ever before! Yes, there have been some dramatic changes and transformation in the world economy, and we are now more connected than ever before, however the world is not flat. (Stiglitz, 2006). Stiglitz in his book ‘Making globalization work’ (2006) touches various aspects of globalization that is destroying the developing countries and their aspirations to provide a decent living to their citizens. He talks about egotistic intellectual property laws, the unfair trade mechanisms and many more critical points to complete success of globalization. Mr Friedman appreciates the existence of global poverty but fails to explain its structural and geopolitical causes.

Thursday, November 7, 2019

Crime and Drug Use misc0 essays

Crime and Drug Use misc0 essays The link between drug use and crime is not a new one. For more than twenty years, both the National Institute on Drug Abuse and the National Institute of Justice have funded many studies to try to better understand the connection. One such study was done in Baltimore on heroin users. This study found high rates of criminality among users during periods of active drug use, and much lower rates during periods of nonuse (Ball et al. 1983, pp.119-142). A large number of people who abuse drugs come into contact with the criminal justice system when they are sent to jail or to other correctional facilities. The criminal justice system is flooded with substance abusers. The need for expanding drug abuse treatment for this group of people was recognized in the Crime Act of 1994, which for the first time provided substantial resources for federal and state jurisdictions. In this paper, I will argue that using therapeutic communities in prisons will reduce the recidivism rates among people who have been released from prison. I am going to use the general theory of crime, which is based on self-control, to help rationalize using federal tax dollars to fund these therapeutic communities in prisons. I feel that if we teach these prisoners some self-control and alternative lifestyles that we can keep them from reentering the prisons once they get out. I am also going to describe some of todays programs that have proven to be very effective. Gottfredson and Hirschi developed the general theory of crime. It According to their theory, the criminal act and the criminal offender are separate concepts. The criminal act is perceived as opportunity; illegal activities that people engage in when they perceive them to be advantageous. Crimes are committed when they promise rewards with minimum threat of pain or punishment. Crimes that provide easy, short-term gratification are often committed. The number of offenders may remain ...

Tuesday, November 5, 2019

Determining Significant Figures

Determining Significant Figures Every measurement has a degree of uncertainty associated with it. The uncertainty derives from the measuring device and the skill of the person doing the measuring. Lets use volume measurement as an example. Say you are in a chemistry lab and need 7 mL of water. You could take an unmarked coffee cup and add water until you think you have about 7 milliliters. In this case, the majority of the measurement error is associated with the skill of the person doing the measuring. You could use a beaker, marked in 5 mL increments. With the beaker, you could easily obtain a volume between 5 and 10 mL, probably close to 7 mL, give or take 1 mL. If you used a pipette marked with 0.1 mL, you could get a volume between 6.99 and 7.01 mL pretty reliably. It would be untrue to report that you measured 7.000 mL using any of these devices because you didnt measure the volume to the nearest microliter. You would report your measurement using significant figures. These include all of the digits you know for certain plus the last digit, which contains some uncertainty. Significant Figure Rules Non-zero digits are always significant.All zeros between other significant digits are significant.The number of significant figures is determined by starting with the leftmost non-zero digit. The leftmost non-zero digit is sometimes called the most significant digit or the most significant figure. For example, in the number 0.004205, the 4 is the most significant figure. The left-hand 0s are not significant. The zero between the 2 and the 5 is significant.The rightmost digit of a decimal number is the least significant digit or least significant figure. Another way to look at the least significant figure is to consider it to be the rightmost digit when the number is written in scientific notation. Least significant figures are still significant! In the number 0.004205 (which may be written as 4.205 x 10-3), the 5 is the least significant figure. In the number 43.120 (which may be written as 4.3210 x 101), the 0 is the least significant figure.If no decimal point is present, the right most non-zero digit is the least significant figure. In the number 5800, the least significant figure is 8. Uncertainty in Calculations Measured quantities are often used in calculations. The precision of the calculation is limited by the precision of the measurements on which it is based. Addition and SubtractionWhen measured quantities are used in addition or subtraction, the uncertainty is determined by the absolute uncertainty in the least precise measurement (not by the number of significant figures). Sometimes this is considered to be the number of digits after the decimal point.32.01 m5.325 m12 mAdded together, you will get 49.335 m, but the sum should be reported as 49 meters.Multiplication and DivisionWhen experimental quantities are multiplied or divided, the number of significant figures in the result is the same as that in the quantity with the smallest number of significant figures. If, for example, a density calculation is made in which 25.624 grams is divided by 25 mL, the density should be reported as 1.0 g/mL, not as 1.0000 g/mL or 1.000 g/mL. Losing Significant Figures Sometimes significant figures are lost while performing calculations. For example, if you find the mass of a beaker to be 53.110 g, add water to the beaker and find the mass of the beaker plus water to be 53.987 g, the mass of the water is 53.987-53.110 g 0.877 gThe final value only has three significant figures, even though each mass measurement contained 5 significant figures. Rounding and Truncating Numbers There are different methods which may be used to round numbers. The usual method is to round numbers with digits less than 5 down and numbers with digits greater than 5 up (some people round exactly 5 up and some round it down). Example:If you are subtracting 7.799 g - 6.25 g your calculation would yield 1.549 g. This number would be rounded to 1.55 g because the digit 9 is greater than 5. In some instances, numbers are truncated, or cut short, rather than rounded to obtain appropriate significant figures. In the example above, 1.549 g could have been truncated to 1.54 g. Exact Numbers Sometimes numbers used in a calculation are exact rather than approximate. This is true when using defined quantities, including many conversion factors, and when using pure numbers. Pure or defined numbers do not affect the accuracy of a calculation. You may think of them as having an infinite number of significant figures. Pure numbers are easy to spot because they have no units. Defined values or conversion factors, like measured values, may have units. Practice identifying them! Example:You want to calculate the average height of three plants and measure the following heights: 30.1 cm, 25.2 cm, 31.3 cm; with an average height of (30.1 25.2 31.3)/3 86.6/3 28.87 28.9 cm. There are three significant figures in the heights. Even though you are dividing the sum by a single digit, the three significant figures should be retained in the calculation. Accuracy and Precision Accuracy and precision are two separate concepts. The classic illustration distinguishing the two is to consider a target or bullseye. Arrows surrounding a bullseye indicate a high degree of accuracy; arrows very near to each other (possibly nowhere near the bullseye) indicate a high degree of precision. To be accurate, an arrow must be near the target; to be precise successive arrows must be near each other. Consistently hitting the very center of the bullseye indicates both accuracy and precision. Consider a digital scale. If you weigh the same empty beaker repeatedly, the scale will yield values with a high degree of precision (say 135.776 g, 135.775 g, 135.776 g). The actual mass of the beaker may be very different. Scales (and other instruments) need to be calibrated! Instruments typically provide very precise readings, but accuracy requires calibration. Thermometers are notoriously inaccurate, often requiring re-calibration several times over the lifetime of the instrument. Scales also require recalibration, especially if they are moved or mistreated.

Sunday, November 3, 2019

Photograhy analysis Essay Example | Topics and Well Written Essays - 1000 words

Photograhy analysis - Essay Example One is in Muslim culture, whereas other is about the western Indian culture. The photographer Roberto Cattani took this shot in Shiraz, Iran. This mosque is known as Nasir al Malik mosque is one of the famous mosque. It is the representational image and the theme of the picture is the semblance of life with colors. The picture depicts the idea that ‘life is in colors’ that is also an undeniable fact .The photographer captured this photograph from an eye level in the daylight. This photograph is consisting on the interior of the mosque. The focus of the picture is on the woman, who is seen as praying in the mosque full of colors that represents the relation of the being to the divine as well as affiliation of life with colors. In this image woman is wearing white, long, and well-draped veil from head to toe and offering prayers on the colorful praying rug, as it is one of the ritual of the religion, which demonstrates soulfulness. Along which there is a sequence of colorful patterned red carpets. Right at the back of the women the wall is delight fully ornamented with the beautiful wall art the shows the essence of Muslim architecture. The walls in the surrounding festooned with the skillfully patterned kaleidoscope windows that demonstrates the value and the reflection of colors on life. In the image, the woman lays in the middle if the picture and surrounded by the beautiful pillars and kaleidoscope at uniform distance that illustrates tranquility and uniformity in the picture. The walls, ceilings, pillar consisting on sequenced, repetitive geometrical motifs and shapes (squared / rectangular and ornamental shapes) that maintains the equilibrium in the photograph. This photograph is properly focused on the kaleidoscope and its reflection as well the exuberance of colors in the surrounding. The palate of the picture shows the vibrancy of the sharp colors that is balanced with the tints of browns and the mildness of

Thursday, October 31, 2019

Description Essay Example | Topics and Well Written Essays - 500 words

Description - Essay Example The trip started out smoothly and nobody felt even a tinge of tiredness. On the way to the Big Bear, we halted at Seven Eleven to grab some energy drinks and continued our trip singing out loudly. The freeway that led us to the mountain was nearly empty and the view was enchanting. We were surrounded by nature with both sides of the freeway covered with mountains and trees. As we neared the mountain, I noticed a sign board that read, â€Å"Snow Chains required beyond this point† and Highway Patrols were blocking the entrance of the mountain. Upon enquiry, they told us that as it had snowed all night the road ahead was covered with snow and ice and that we would require tire chains to move ahead. On hearing this, however, our excitement did not wean and we drove back to the city below the mountains and bought some tire chains. We then pulled over just before the blockade, to put on the chains. The weather outside was freezing cold as we got out of the car which was a black two- door coupe model with a long hood, a short trunk and big tires. I had previously encountered problems with the tires as they had a tendency to slip when the ground was wet. But now I was not worried as the snow chains looked powerful and reliable, though it was quite a challenge to fix them. After struggling with the chains for about 30 minutes, my hands began to feel cold and sensitive due to the freezing weather. The effort was in vain and we finally engaged a mechanic to fix the chains and paid him $50 for the job. Another problem also lay ahead as I had never driven on icy roads. Though I took pride in my driving skills I was a bit apprehensive at that moment. As I resumed driving, the mountain road seemed fine from where the Highway Patrols stopped us, but once we reached the first curve, the true reality of the situation dawned on us. The road ahead was completely snow covered with only a few sections of the road visible. There were curves once after every 300 feet with

Tuesday, October 29, 2019

Strategic Management Unit 3 IP Research Paper Example | Topics and Well Written Essays - 1500 words

Strategic Management Unit 3 IP - Research Paper Example First, such firms benefit from gaining market share and further positioning themselves in best locations. This could affect the theory in that higher market share could cause an increase in cost of operation thus diluting the associated high returns. Secondly, first movers gain new knowledge relevant for success in their fields (Li, Lam, Karakowsky & Qian, 2003). Changes in the knowledge could cause the first mover to find ways to fast learn the emerging knowledge. Being the first, such firms also secure resources and commitments for their provision (Eggers, Grajek & Kretschmer, 2011). This impacts the theory in the context where there is limited information on the resources available. Finally, they have the advantage of establishing and securing long-term relationships with investors, suppliers, customers and distributors, an important concept for firms seeking to develop long lasting business entities. However, Hill, Jones and Schilling (2013) observe that first movers suffer cost disadvantage as they have to establish most of the infrastructure from scratch. This affects the theory in that organisation that requires high set-up capital shy away from pioneering markets, products or services. There is a high uncertainty associated with first movers. This would particularly impact on the theory if the entity is not familiar with the regulations, needs and culture of the target geographical regions. Thirdly, first movers face the risk of adopting a losing strategy that would make them fail and leave opportunities for late entrants who would have learnt from their mistakes (David, 2013). This would be the case if the first mover would not be able to make predictions on their investments. Finally, first movers could invest in obsolete or inferior technology, making this theory particularly unappealing to entities in businesses where technology advances

Sunday, October 27, 2019

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym