Description Essay Example | Topics and Well Written Essays - 500 words

Description - Essay Example The trip started out smoothly and nobody felt even a tinge of tiredness. On the way to the Big Bear, we halted at Seven Eleven to grab some energy drinks and continued our trip singing out loudly. The freeway that led us to the mountain was nearly empty and the view was enchanting. We were surrounded by nature with both sides of the freeway covered with mountains and trees. As we neared the mountain, I noticed a sign board that read, â€Å"Snow Chains required beyond this point† and Highway Patrols were blocking the entrance of the mountain. Upon enquiry, they told us that as it had snowed all night the road ahead was covered with snow and ice and that we would require tire chains to move ahead. On hearing this, however, our excitement did not wean and we drove back to the city below the mountains and bought some tire chains. We then pulled over just before the blockade, to put on the chains. The weather outside was freezing cold as we got out of the car which was a black two- door coupe model with a long hood, a short trunk and big tires. I had previously encountered problems with the tires as they had a tendency to slip when the ground was wet. But now I was not worried as the snow chains looked powerful and reliable, though it was quite a challenge to fix them. After struggling with the chains for about 30 minutes, my hands began to feel cold and sensitive due to the freezing weather. The effort was in vain and we finally engaged a mechanic to fix the chains and paid him $50 for the job. Another problem also lay ahead as I had never driven on icy roads. Though I took pride in my driving skills I was a bit apprehensive at that moment. As I resumed driving, the mountain road seemed fine from where the Highway Patrols stopped us, but once we reached the first curve, the true reality of the situation dawned on us. The road ahead was completely snow covered with only a few sections of the road visible. There were curves once after every 300 feet with

Strategic Management Unit 3 IP Research Paper Example | Topics and Well Written Essays - 1500 words

Strategic Management Unit 3 IP - Research Paper Example First, such firms benefit from gaining market share and further positioning themselves in best locations. This could affect the theory in that higher market share could cause an increase in cost of operation thus diluting the associated high returns. Secondly, first movers gain new knowledge relevant for success in their fields (Li, Lam, Karakowsky & Qian, 2003). Changes in the knowledge could cause the first mover to find ways to fast learn the emerging knowledge. Being the first, such firms also secure resources and commitments for their provision (Eggers, Grajek & Kretschmer, 2011). This impacts the theory in the context where there is limited information on the resources available. Finally, they have the advantage of establishing and securing long-term relationships with investors, suppliers, customers and distributors, an important concept for firms seeking to develop long lasting business entities. However, Hill, Jones and Schilling (2013) observe that first movers suffer cost disadvantage as they have to establish most of the infrastructure from scratch. This affects the theory in that organisation that requires high set-up capital shy away from pioneering markets, products or services. There is a high uncertainty associated with first movers. This would particularly impact on the theory if the entity is not familiar with the regulations, needs and culture of the target geographical regions. Thirdly, first movers face the risk of adopting a losing strategy that would make them fail and leave opportunities for late entrants who would have learnt from their mistakes (David, 2013). This would be the case if the first mover would not be able to make predictions on their investments. Finally, first movers could invest in obsolete or inferior technology, making this theory particularly unappealing to entities in businesses where technology advances

Epigenetic Control of Endocannabinoid Function

Epigenetic Control of Endocannabinoid Function Janis Szeremeta Epigenetic control of endocannabinoid function Prostate cancer is one of the most frequently diagnosed types of tumours in the male population worldwide. The endocannabinoid system, more specifically high expression of cannabinoid receptor 1 (CB1) in tumour tissue, has been associated with poor prognosis in prostate cancer and suggested as a prognostic marker. Epigenetic silencing has previously been shown to upregulate CB1 mRNA expression in colon cancer cell lines and to induce expression of normally silenced cannabinoid receptor 2 (CB2) mRNA in a neuroblastoma cell line. In the present study, potential effects of epigenetic modulation on the expression of 12 different components of the endocannabinoid system (receptors, synthetic and catabolic enzymes) were investigated in a prostate cancer and a neuroblastoma cell line. Additionally, two catabolic pathways were investigated in functional assays. In general, changes in mRNA expression levels produced by treatment with the epigenetic modulators, 5-aza-2-deoxycytidine and Tricho statin A were small, and, in the case of the catabolic enzyme fatty acid amide hydrolase in DU-145 prostate cancer cells were not accompanied by observable changes in hydrolysis rates. In SH-SY5Y neuroblastoma cells a low expression of monoacylglycerol lipase was found and this was also observed in functional assays. It is concluded that for the cell lines investigated, the epigenetic modulators tested do not modify the endocannabinoid system to any obvious degree, at least at the mRNA level. Since these experiments were conducted on a single cell line of a specific cell type only, introduction of alternative prostate cancer cell lines, such as PC-3 or LNCaP, might have different outcomes and should be considered for future experiments. Due to its involvement in a variety of physiological and pathophysiological conditions, such as obesity, pain, immunomodulation and cancer1, the endocannabinoid system has emerged as an important area of research. Endogenous lipid transmitters, the so-called endocannabinoids, act by binding and activating the G-protein coupled cannabinoid receptors 1 and 2 (CB1/ CB2). Endocannabinoid levels are tightly regulated by a network of synthesizing and catabolizing enzymes (Figure 1). Two lipid mediators, N-arachidonoylethanolamine (anandamide, AEA) and 2-arachidonoylglycerol (2-AG), remain the most thoroughly studied endocannabinoids to date. 2-AG is derived from hydrolysis of diacylglycerols (DAGs) containing arachidonic acid via diacylglycerol lipases ÃŽÂ ± and ÃŽÂ ² (DGLÃŽÂ ±/ÃŽÂ ²) and then hydrolysed to arachidonic acid mainly via monoacylglycerol lipase (MGL) but also by ÃŽÂ ±/ÃŽÂ ²-hydrolase domain containing 6 and 12 (ABHD6, ABHD12)2. AEA is derived from N-acylphos phatidylethanolamines (NAPEs) by hydrolysis via NAPE-phospholipase D (NAPE-PLD). It is inactivated by hydrolysis via fatty acid amide hydrolase (FAAH) and N-acylethanolamine acid amide hydrolase (NAAA) to arachidonic acid. Arachidonic acid is a substrate for many enzymes, including cyclooxygenase (COX) -1 and -2, 5- and 12-lipoxygenases (5/12-LOX) to produce prostaglandins, 5- and 12- hydroxyicosatetraenoic acid (5/12-HETE), respectively. Both 2-AG and AEA can also be hydrolysed to prostaglandin H2 derivatives via COX-23. Current modulators of the endocannabinoid system include a variety of selective pharmacological inhibitors for these enzymes which can be used to study their functional roles in the body (see Figure 1 for compounds used in this study). Figure 1: Simplified view of the endocannabinoid system. G-protein coupled receptors CB1 and CB2 are activated by lipid mediators, in this case 2-AG and anandamide (AEA) as well as by plant derived and synthetic compounds (not depicted). 2-AG and AEA are synthesized from diacylglycerol or N-acylphosphatidylethanolamine precursors and act locally. Both messengers are hydrolysed to arachidonic acid and/or prostaglandin H2 derivatives. Descriptions given in green were investigated towards changes in mRNA expression following epigenetic modulation treatment. Descriptions given in red show endocannabinoid metabolizing enzyme inhibitors. Abbreviations: Penta, Pentadecylamine (after Muccioli 20103). The endocannabinoid system is becoming a more and more important therapeutic target in cancer, and very interestingly, different types of cancer appear to react differently to changes in endocannabinoid balance, with oftentimes opposing effects ranging for example from pro- to antiapoptotic4. This shows why understanding how the endocannabinoid system is regulated in health and disease remains an important part of research. An important hallmark of cancer formation of cancer is the occurrence of epigenetic alterations5,6. Aberrant DNA methylation has been found in various types of cancer and effects vary between hyper- and hypomethylation states and in different types of cancer (see Kulis et al 20107). DNA methylation is usually associated with inhibition of gene expression. Cytosine nucleotides are methylated at the fifth carbon to form 5-methylcytosine, which can hinder transcription factor binding and therefore interfere with gene expression8. 5-Aza-2-deoxycytidine is a DNA demethylation compound that is able to replace and mimic cytosine in the DNA. In case of a cytosine replacement, DNA methyltransferases (DNMTs), that would normally catalyse methylation of cytosines, will now be bound covalently to 5-Aza-2-deoxycytidine, leading to degradation and depletion of DNMT protein levels and therefore a decrease of DNA methylation9. Note that this process is unspecific and generally decreases overall DNA methylation. Histone acetylation, a different type of epigenetic modification, is associated with activation of gene transcription. Occurring on lysine residues of histones, histone acetylation is associated with a charge neutralization of the positively charged histone molecules. This neutralization reaction is thought to decrease interaction between negatively charged DNA phosphate backbones and their positively charged histone counterparts, therefore increasing DNA availability10. Histone acetylation is regulated by an interplay of histone acetylases (HATs) and histone deacetylases (HDACs)11. Inhibition of HDACs may be used to constitutively activate histone acetylation mediated gene expression. Prostate cancer has become one of the most frequently diagnosed malignancies in men throughout Europe12. Current evidence suggests that high a CB1 receptor immunoreactivity is correlated to disease severity and outcome13. Several prostate cancer cell lines and human prostate cancer tissues have been shown to express CB1 receptors using various techniques, such as qPCR, immunofluorescence and western blotting13-16. There is evidence that CB1 expression is regulated epigenetically in colorectal cancer, where DNA hypermethylation lead to a loss of CB1 expression17. The same study found inhibition of epigenetic silencing (i.e. removal of DNA methylation) increased Cnr1 mRNA expression in seven out of eight colorectal cancer cell lines. A different study investigated the effects of two different epigenetic modulators, 5-Aza-2-deoxycytidine (Aza dC) and Trichostatin A (TSA), a histone deacetylase inhibitor, upon CB receptor expression in two different cell lines18. Inhibition of epigenetic silencing in Jurkat T cells increased Cnr1 mRNA expression in an additive manner but did not affect Cnr2 mRNA expression, whereas treatment of human SH-SY5Y neuroblastoma cells lead to induction of normally silenced Cnr2 mRNA expression, again in an additive manner, but no changes in Cnr1 mRNA. Whilst the above data implicate epigenetic regulation of CB receptors, it is not known whether it is seen in prostate cancer cells, and there is no data concerning the endocannabinoid synthetic and catabolic enzymes. In consequence, the present study investigated the effects of Aza dC and Trichostatin A treatment upon mRNA expression for 12 different endocannabinoid-related genes (see Figure 1). Differences that were found were investigated in hydrolysis experiments and changes in either AEA or 2-AG hydrolysis. In addition, since tumours are often located in hypoxic microenvironments19, cell lines were exposed to hypoxic conditions for increasing intervals up to 24 h and the same panel of endocannabinoid system components was investigated towards mRNA expression. Cells were either placed into anoxic incubation chambers or exposed to hypoxia mimetics such as Co(II)Cl220 or deferoxamine21. Drugs and Compounds Radiolabeled compounds ([3H]-2-OG (60 Ci/mmol)), [3H]-AEA (60 Ci/mmol)) were obtained from American Radiolabeled Chemicals Inc, St. Louis, MO, USA. URB597, JZL184, WWL70 were obtained from the Cayman Chemical Co. (Ann Arbor, MI, USA). Pentadecylamine, 5-Aza-2-deoxycytidine (Aza dC), Trichostatin A, Co(II)Cl2 were obtained from Sigma-Aldrich (St. Louis, MO, USA). Cell Culture Human DU-145 (prostate cancer, passage range 17 to 29) and SH-SY5Y (neuroblastoma, passage range 19 to 28) cells were expanded in Eagles Minimal Essential Medium (EMEM ATCC 30-2003) supplemented with penicillin, streptomycin (10,000 U/mL each, Gibco by Life Technologies) and 10% FBS (Gibco by Life Technologies) in 75 mL flasks at 37ËÅ ¡C with 5% atmospheric CO2. Cells were plated in 24 well plates with a total number of cells of 1.5 ÃÆ'- 105 for DU-145 and 2.5 ÃÆ'- 105 cells for SH-SY5Y per well overnight. Epigenetic Modulation using 5-Aza-2-deoxycytidine and Trichostatin A Following the overnight plating, DU-145 and SH-SY5Y cells were treated by replacing the old medium with a fresh layer of medium containing Aza dC (1  µM), Trichostatin A (25 nm), a combination of both, or vehicle (DMSO 0.1%) as control for 24 h. After 24 h hours, cells were lysed according to the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) instructions and mRNA was extracted. Exposure to Hypoxia/Hypoxia Mimetics Induction of hypoxia was achieved via two different methods. Cells were seeded into 24 well plates and either kept in a hypoxic environment or were exposed to the hypoxia mimetic Co(II)Cl2. A hypoxic atmosphere inside an airtight modular incubation chamber (Billups Rothenberg Inc, San Diego, CA, USA) was achieved by first flushing the medium with a hypoxic gas mix (1% O2, 99% CO2) at a rate of 3 L/min for 5 minutes. The old medium was replaced with a layer of flushed medium and plates were placed into the airtight chamber. The chamber was flushed with hypoxic gas at a rate of 20 L/min for 5 minutes (per manufacturers instructions22) and then incubated at 37ËÅ ¡C for either 2, 4, 6, 8 or 24 h. Co(II)Cl2 was used at a final concentration of 50 mM and cells were incubated for 2, 4, 6, 8 or 24 h. HIF1ÃŽÂ ± and HIF2ÃŽÂ ± mRNA levels were assessed for both procedures to evaluate induction of hypoxia. qPCR mRNA was extracted using the Dynabeads ® mRNA DIRECT„ ¢ Purification Kit. mRNA (5  µg of total) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems, Thermo Fisher Scientific). qPCR reaction mixtures were prepared using the KAPA SYBR FAST qPCR Master Mix (2X, KAPA Biosystems, Wilmington, MA, USA) to a final Volume of 20  µL. Reactions were run on the Illumina Eco Real Time PCR system (Illumina Inc, San Diego, CA, USA) with an initial denaturation time of 10 minutes at 95ËÅ ¡C, 45 cycles of 10 seconds at 95ËÅ ¡C and 30 seconds at 60ËÅ ¡C and melting curve cycle times of 15 seconds at 95ËÅ ¡C, 15 seconds at 55ËÅ ¡C and a final step of 95ËÅ ¡C for an additional 15 seconds. Primers (Table 1) were synthesized at Integrated DNA Technologies (Coralville, IA, USA). Amounts of transcripts were normalized to ribosomal protein L19 (RPL19) and relative quantification was perf ormed using the ˆâ€  Ã‹â€ Ã¢â‚¬  Ct method. Table 1: primers used for qPCR experiments Gene Product Forward primer (5 to 3) Reverse primer (5 to 3) Abhd6 ABHD6 GATGTCCGCATCCCTCATAAC CCAGCACCTGGTCTTGTTTC Abhd12 ABHD12 GGCAGAAAGCTCTATAGCATCG CCTGTAGCCAAGGTCTGAATG Cnr1 CB1 CACCTTCCGCACCATCACCAC GTCTCCCGCAGTCATCTTCTCTTG Cnr2 CB2 1st pair CATGGAGGAATGCTGGGTGAC GAGGAAGGCGATGAACAGGAG CB2 2nd pair AAACAACTGGGACTCCTC GTCTAGAAGGCTTTGGGTTG Ptgs2 COX-2 AGCAGGCAGATGAAATACCAG ACCAGAAGGGCAGGATACA Dagla DAGLÃŽÂ ± CCCAAATGGCGGATCATCG GGCTGAGAGGGCTATAGTTAGG Daglb DAGLÃŽÂ ² TCAGGTGCTACGCCTTCTC TCACACTGAGCCTGGGAATC Faah FAAH CACACGCTGGTTCCCTTCTT GGGTCCACGAAATCACCTTTGA Hif1a HIF1ÃŽÂ ± GCTGATTTGTGAACCCATTCC TTCATATCCAGGCTGTGTCG Epas1 HIF2ÃŽÂ ± CACAGAGTTCTTGGGAGCAG ACCCTTTGCAGACCTTGTC Alox5 5-LOX ATCCAGCTCAACCAAATCCC ACCAGATGTGTTCGCAGAAG Alox12 12-LOX GATCCGAGGAGAGAAGCAATAC GGAGGCTGAATCTGGATGAC Alox15 15-LOX CGAGGGTTTCCTGTCTCTTTAC GCACCCAAGAGTACCAGTC Mgll MAGL GGAAACAGGACCTGAAGACC ACTGTCCGTCTGCATTGAC Naaa NAAA ATGGAGCGTGGTTCCGAGTT AGGCTGAGGTTTGCTTGTCCT Napepld NAPE-PLD ACTGGTTATTGCCCTGCTTT AATCCTTACAGCTTCTTCTGGG Rpl19 RPL19 CACATCCACAAGCTGAAGGCA CTTGCGTGCTTCCTTGGTCT [3H]-AEA Hydrolysis in DU-145 Cells The assay of Bjà ¶rklund et al. (2014)23 was used. Cells (1.5 ÃÆ'- 105 per well) were plated and kept overnight to allow for cell adherence. Subsequently, cells were treated with Aza dC (1  µM) for 24 h or left untreated as control. Non-enzymatic hydrolysis was measured in non-cell containing wells. Wells were washed with KRH buffer (120 mM NaCl, 4.7 mM KCl, 2.2 mM CaCl2.2H2O, 10 mM HEPES, 0.12 mM KH2PO4, 0.12 mM MgSO4 containing 1% BSA (Sigma Aldrich) followed by KRH buffer alone. KRH buffer containing 0.1% fatty-acid free BSA (Sigma Aldrich) was added to the wells and plates were kept in a water bath at 37ËÅ ¡C. Inhibitors (URB597 1  µM, Pentadecylamine 1  µM, URB597 and Pentadecylamine 1 µM each) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C. [3H]-AEA (diluted with non-radioactive AEA to give a final assay concentration of 0.5  µM) was added and plates were incubated for a further 15 minutes resulting in a total reaction vol ume of 400  µL. The hydrolysis reaction was stopped by adding 600  µL activated charcoal in 0.5 M hydrochloric acid and plates were kept on ice. Charcoal and aqueous phase were separated by centrifugation (2,500 rpm, 10 min.), 200  µL of the aqueous phase were recovered and mixed with 4 mL scintillation liquid (ULTIMA GOLD, PerkinElmer) for liquid scintillation radioactivity determination with quench correction. The [3H]-AEA used is labelled in the ethanolamine part of the molecule, and the [3H]-ethanolamine produced by the hydrolysis of [3H]-AEA does not adsorb to the charcoal, whereas the [3H]-AEA does adsorb24. [3H]-2-OG Hydrolysis in SH-SY5Y Cells Cells (2.5 ÃÆ'- 105 per well) were plated and incubated overnight to allow for cell adherence. Non-enzymatic hydrolysis was measured in non-cell containing wells. The assay used was the same as for [3H]-AEA hydrolysis, but using 0.5  µM [3H]-2-OG (labelled in the glycerol part of the molecule). Inhibitors (URB597 1  µM, JZL184 1  µM, WWL70 10  µM, a combination of URB597, JZL184 and WWL70 and a combination of JZL184 and WWL70 at the aforementioned concentrations) or vehicle (DMSO 0.1%) were added and plates incubated for 10 minutes at 37ËÅ ¡C followed by addition of substrate and incubation for a further 15 min. See above for determination of radioactivity in aqueous phase. Cytotoxicity Assessment/Assay To determine the cytotoxicity of the various treatments throughout this project the LDH cytotoxicity detection kit from Roche (Cat. No. 11 644 793 001) was used per manufacturers protocol. Statistical Analyses Statistical analyses were undertaken by my Supervisor using the function ezANOVA in the package ez for the R statistical programme (R Core Team, URL http://www.R-project.org/). The details and the command lines used are given in Table 2. Epigenetic regulation of endocannabinoid function DU-145 and SH-SY5Y cells were treated for 24h with either Aza dC, TSA or a combination of both compounds, after which mRNA was extracted and analused for expression of marker of the endocannabinoid system. Table 2 shows the summarized data of the statistical analysis obtained in the gene expression studies. Main effects are given in the left half of the table. Significant differences were found for a various number of genes and are given in bold type. Main effects cell describes the comparison of gene expression between DU-145 and SH-SY5Y cells. The columns with Aza dC and TSA describe the effect of the epigenetic modulators on mRNA expression of the gene of interest and only a few of them were statistically significant (i.e. DGLÃŽÂ ² and FAAH for Aza dC and 12-LOX for TSA). Interpretation of the main effects is difficult when there are significant interactions. Values in bold type indicate an interaction between components) for four of the twelve genes of interest. In these cases, individual two-way ANOVAs helped to determine actual differences for each cell line per se. Results of these ANOVAs can be found below their corresponding figures (see Figure 2, Figure 3 and Figure 4) with a P Table 2: Three-way ANOVA summary for the PCR data. Main effects Interactions Cell: Cell: Cell: Aza dC: Aza dC: Protein Cell Aza dC TSA Aza dC TSA TSA TSA CB1 0.0003 0.31 0.060 0.38 0.89 0.14 0.30 NAPE-PLD 0.34 0.40 0.28 0.0093 0.29 0.29 0.54 DGLÃŽÂ ± 0.87 0.88 0.0049 0.49 0.16 0.61 DGLÃŽÂ ² 0.43 0.0004 0.027 0.020 0.031 0.88 0.96 FAAH 0.041 0.0061 0.55 0.17 0.85 NAAA 0.012 0.53 0.44 0.79 0.15 0.40 MGL 0.21 0.019 0.014 0.85 0.25 0.59 ABHD6 0.0004 0.019 0.15 0.0001 0.70 0.43 0.67 ABHD12 0.0078 0.014 0.65 0.091 0.14 0.61 0.11 COX2 0.032 0.62 0.21 0.70 0.83 0.74 5-LOX 0.99 0.45 0.21 0.91 0.98 0.13 0.53 12-LOX 0.0039 0.18 0.0001 0.41 0.55 0.93 0.69 Data shows the ANOVA p values for each protein, calculated for the data expressed as ˆâ€  Ct using the function ezANOVA in the package ez for the R statistical programme. The command line used was Model25). P values in bold type are those where significance remained after implementation of a 5% false discovery rate (Benjamini Hochberg, 199526). When the interaction cell type x Aza dC was significant, two-way ANOVA matching for Aza dC and TSA have been calculated for each cell type separately, and these are shown in the figures. Note that for DGLÃŽÂ ² and MGL the variances were different for the DU145 and SH-SY5Y cells and this will affect accuracy of the P values. In these cases, the cells have been analysed separately and the ANOVA values given in the figures. Cannabinoid receptors 1 and 2 Figure 2: Panel A, mRNA levels for CB1 receptors in DU145 and SH-SY5Y cells treated with Aza dC and/or TSA. The graphs show the individual ˆâ€  Ct values (bars show the means), N=6 per group (each assayed in triplicate), with the corresponding % of controls on the right column. For statistical treatment, see Table 2. Panel B, melting curves for the primers used for CB1 and CB2 receptors. The melting curves are for the DU145 cells. Gene expression analysis data of CB1 mRNA is given in Figure 2A. Expression rates were significantly different between the two cell lines, but neither Aza dC nor Trichostatin A had an effect. No interactions between the compounds and the cell types were found (Table 2) Unfortunately, two different primer pairs, designed to amplify Cnr2 mRNA did not give detectable and reproducible mRNA expression of CB2, so no expression data could be obtained for CB2 (Figure 1B). The first primer pair was taken from a previous publication by Bà ¶rner et al whereas the second pair was designed on site. Figure 1B shows the different melting curves obtained during the qPCR assays for DU-145, with similar results for SH-SY5Y cells. Endocannabinoid synthetic enzymes Figure 3: mRNA levels of the endocannabinoid synthetic enzymes NAPE-PLD (A), DGLÃŽÂ ± (B) and DGLÃŽÂ ² (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panels A and B) or when the variance was different for the two cell types (Panel C). Effects of epigenetic modulation on the expression of endocannabinoid synthetic enzymes are shown in Figure 2. No main effects of either Aza dC or TSA were detected for NAPE-PLD or DGLÃŽÂ ±, there was an interaction between the different cell types and the Aza dC treatment, however (see Table 2). For these samples a two-way ANOVA was calculated and values are given below each figure. Indiviual treatments did not have any significant effect on the expression of both NAPE-PLD and DGLÃŽÂ ± (Figure 2A and B), an additive effect of Aza dC and TSA could be observed for the expression of DGLÃŽÂ ± in DU-145 cells, where expression decreased to a small degree. For DGLÃŽÂ ², since the variance was different for both cell types, a two-way ANOVA was calculated for each. No significant effects were observed for DGLÃŽÂ ² expression in SH-SY5Y cells. However, both Aza dC and TSA had significant main effects in the DU-145 cells, although the sizes of the changes produced by the compou nds were very small (Figure 2C). AEA catabolic enzymes Figure 4: mRNA levels of the endocannabinoid catabolic enzymes FAAH (A) and NAAA (B). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel A). As seen in Table 2, Aza dC had both a significant main effect, but also displayed interaction between the cell types and the compound for FAAH. The two-way ANOVA for FAAH resulted in significant differences only for the Aza dC treatment in DU-145, but not in SH-SY5Y. Once again, the effects were very small in size. Trichsotatin A did not have an effect in either cell line, neither individually nor in combination (Figure 3A). No significant differences were found for NAAA (Figure 3B). 2-AG catabolic enzymes Figure 5: mRNA levels of the endocannabinoid catabolic enzymes MGL (A), ABHD6 (B) and ABHD12 (C). Two-way repeated ANOVA are shown when the interaction Cell x Aza dC in Table 2 was significant (Panel B) or when the variance was different for the two cell types (Panel A). Gene expression analysis of the three key enzym

JFK and the Warren Commission :: American America History

JFK and the Warren Commission Why did the Warren Commission decide that John F Kennedy was shot by Lee Harvey Oswald, acting on his own? On 22 November 1963, President John F Kennedy was shot dead as he took part in a motorcade through the streets of Dallas, Texas. Soon afterwards a man named Lee Harvey Oswald was arrested and accused of having shot Kennedy from the sixth floor of the Texas school Depository building . Even though Oswald refused to co-operate and denied all knowledge of the assassination, he was formerly charged the next day, on the 23 November. However, he never stood trial as just two days later Oswald himself was shot dead by Jack Ruby, a Dallas night club owner, as he was being taken from police headquarters to court. As Jack Ruby went to prison and the police had no longer a suspect to question, President Lyndon Baines Johnson, set up a committee led by chief justice Earl Warren, to conduct an official investigation into Kennedy's murder. They were under immense pressure by the public to come up with a conclusion. On 24 September 1964, the Warren Commission finally issued a report of their findin gs. They concluded that President Kennedy was murdered by a single gunmen, Lee Harvey Oswald. There were numerous reasons why the Warren Commission came to this conclusion, varying from Oswalds background and most predominantly the hard evidence there was against him. In fact, there was a substantial amount of evidence that linked Oswald to the murder weapon and the crime scene which, undoubtedly helped a great deal in his conviction. The main evidence against Oswald was a unique Mannlicher-Carcano rifle, which was recovered on the sixth floor of the school depository building and had allegedly been used for the shooting. Witnesses claimed that three shots had been fired. Three spent cartridges were found alongside the rifle. Ballistics proved that the fragments from two bullets that were recovered from the Presidents limousine and from the wounds of Kennedy and Governor Connally, came from the same unusual type of rifle, made in Italy during the Second World War. Forsenic evidence also linked Oswald to the weapon. Fibres found on the rifles stock matched those on a shirt Oswald was wearing when he was arrested. Oswalds palm prints were also found on the underside of the gun barrel. His prints were found on a part of the rifle that was exposed only when it was taken to pieces.

Othello’s Tragic Flaws Essay

William Shakespeare creates dynamic and complex characters in his tragic play, Othello. Othello, Iago, Desdemona, and Emilia each display a tragic flaw. Shakespeare’s subtle descriptions of the characters allow for varying interpretations of each character. The tragic flaws can truly alter perspectives as the story transitions. A tragic flaw can begin as a positive character trait, yet spiral into the downfall of the respective character. Shakespeare thoroughly expresses the importance of tragic flaws in the play Othello. Shakespeare provides the title character with the tragic flaw of inherent trust in others, particularly in Iago. Iago’s ambition, Desdemona’s love for Othello, and Emilia’s loyalty in Iago and Desdemona are also tragic flaws. These tragic flaws are imperative to the play, and without them there would be a lack of plot, conflict, and climax. Othello’s tragic flaw of inherent trust haunts him throughout the play. Othello is easily pe rsuaded and this leads him to put his trust in the wrong people. He unfortunately gets ensnared into Iago’s devious plan. Othello treats Iago as a trust-worthy friend who he has known for a long period of time. When Iago realizes that Othello believes the story about Cassio’s relationship with Desdemona, Iago decides to take the scheme further. Iago places horrid images in Othello’s mind that turn Othello into a rash man. Othello’s tragic flaw ultimately leads to his destruction. Othello’s personality vastly transforms due to the madness. Othello ironically mistrusts his loyal wife Desdemona and good friend Cassio. When Othello places Desdemona on her deathbed, he states, â€Å"Be thus when thou are dead, and I will kill thee/And love thee after† (V.ii.20-21). At this moment in the play, Othello’s actions are ironic. Originally, Othello worried that Desdemona would stab him in the back, but he is the one who betrays his beloved wife. Othello is brought to this action because Iago places extreme jealousy within him. Emilia enters Othello’s room and discovers that she has walked into another murder. Othello still has a degree of trust in â€Å"honest† Iago, but Emilia informs Othello of her husband’s lies. Othello may subconsciously realize the mistakes he has made, but he does not want to believe Emilia and face the truth. In response to Emilia, Othello states, â€Å"I say thy husband. Dost understand the word? My friend, thy husband; honest, honest, Iago† (V.ii.188-189). Although Iago’s plan is obvious to the audience, Othello refuses to believe it. Iago’s actions have already destroyed Othello’s marriage, but Iago continues until Othello ruins his entire life. Iago is a dishonest and devious character, but his main tragic flaw is his undying ambition to take down Othello and Cassio. In the play, Iago manipulates several characters and tends to extend his actions too far. Iago constantly manipulates his wife Emilia and treats her as his pet. He continuously disrespects her and uses her to advance his plans. However, Emilia has a growing sense of suspicion towards her evil husband as the play carries on. When Iago is planning to overthrow Cassio with the handkerchief, he states, â€Å"A good wench! Give it to me† (III.iii.359). Emilia finds this very suspicious. She wonders why this handkerchief is so vital to Iago as it belonged to Desdemona. At this moment, Emilia realizes something is brewing and notices that this is the time to act upon her disrespectful husband. Emilia knows how devious Iago can be, and how important it would be to earn a stronger position. She knows Iago will do anything to get his hands on the lieutenancy by ta king it from Cassio. For instance, Iago is jealous of Othello’s power and is determined to steal his throne as well as his wife. When Iago learns that Othello is very trusting, he becomes very eager to take advantage of this overthrow Othello at a rapid pace. However, instead of being patient, Iago includes Cassio, Emilia, and Roderigo in his agenda to gain power. Involving several people in his plan backfires and interferes with his plan because all his actions eventually catch up to him. For example, Emilia becomes very suspicious of her husband’s desperation to possess the handkerchief. Emilia dislikes the way her husband treats her and becomes very anxious to catch him doing something devious. By the end of the play Emilia says, â€Å"You told a lie, an odious, damned lie! Upon my soul, a lie, a wicked lie† (V.ii.216-217). Emilia finally confronts her two-faced husband. Due to Iago’s extreme desire for power, his reckless actions eventually catch up t o him. His wife turns on him and tells people about his recent actions. Iago is finally held responsible for his actions and taken away for a long period of torture. Throughout the story, Desdemona relies heavily on Othello and his love for her. She believes that she and Othello have an everlasting relationship. Unfortunately, she is clueless about Othello’s trust in Iago. She does not know that he is feeding Othello appalling lies about her and Michael Cassio. Although Othello is the love of Desdemona’s life, his tragic flaw causes him to become extremely jealous. In the beginning of the play, Othello and Desdemona openly display their love for each other for others to see. Iago knows that in order to disrupt their passionate love, he is going to have to convince one of them that the other is cheating on them. Iago chooses to convince Othello of Desdemona’s â€Å"affair† with Cassio, and Othello does not hesitate to trust Iago’s statements and immediately believe that Desdemona is cheating on him. Othello knows that she betrayed her own father, Brabantio, and therefore conceives that Desdemona could potentially to the same to him. Othello starts acting as a demon is inside of him, but Desdemona does not understand the reason. As Othello’s jealousy starts to build up, Desdemona states, â€Å"Why ten tomorrow night, (or) Tuesday morn, on Tuesday noon or night’ on Wednesday morn† (III.iii.68-69). Othello shows obvious anger about Cassio to Desdemona. Instead of attempting to fix the situation, Desdemona hopes this side of Othello will pass. This is the key factor in the start of Othello’s envy towards Cassio due to Iago’s fatal lies. Desdemona continues to believe that nothing stands a chance of interfering with her and Othello’s relationship. Meanwhile, Othello fails to look at Desdemona the same way believing that she has been seeing Cassio behind his back. As the play progresses, Othello’s jealousy is getting increasingly worse and Desdemona does not act in response to Othello’s harsh behavior. As Desdemona lays hopelessly in her dea thbed, she does not panic, however, she acts as if Othello is not going to kill her. As Othello smothers Desdemona, she eventually states to Emilia, â€Å"Nobody. I myself. Farewell. Commend me to my kind lord. O, farewell† (V.152-153). Desdemona expresses her undying love for Othello by explaining to Emilia that she took her own life away. She cannot believe that Othello would kill her because her love blinds her. Therefore, love is Desdemona’s tragic flaw. Emilia contains the tragic flaw of loyalty. She exhibits this loyalty particularly to her husband and to Desdemona. Although Emilia receives disrespect from her husband, she perpetually shows Iago loyalty throughout most of the play. When Emilia picks up the handkerchief that Desdemona drops, she hesitates to give it to Iago. However, she does give it to Iago because there is some loyalty that exists in her towards her husband. As Iago demands the handkerchief from Emilia, she questioningly states, â€Å"What will you do with ‘t, that you have been so earnest to have me filch it?† (III.iii.360-362). Emilia knows her husband is up to something and it is up to her to stop it. Although for most of the story Emilia is loyal to Iago, she also has loyalty to Desdemona. Emilia discovers that Iago uses the handkerchief to frame Cassio and destroy the relationship between Othello and Desdemona. When Emilia walks into the murder of Desdemona, she knows she has missed her opportunity to catch her husband in the act framing Desdemona. Her minimal amount of remaining respect for her husband is eliminated at this moment, a nd she tells everyone that it is Iago that has stolen the handkerchief in order to blame Desdemona. Emilia’s secret strength is evident. Emilia states, â€Å"O thou dull Moor, that handkerchief tho speak’st of I found by fortune, and did give my husband—For often, with a solemn earnestness (More than indeed belonged to such a trifle), He begged of me to steal’t† (V.ii.267-272). Emilia explains to Othello that he has fallen into Iago’s trap. Emilia tells everyone in the room that Iago asked for the handkerchief, and shows her loyalty to Dedemona by proving her innocence. When Emilia displays her loyalty towards Desdemona this way, it angers Iago thoroughly and ruptures his plan completely. In response to Emilia’s actions, Iago takes out his rapier and stabs her. She dies on the same bed as Desdemona. The two innocent female lives are lost in the same spot. Overall, the tragic flaw of loyalty that Emilia expresses is her downfall. Tragic flaws are a critical component of Shakespeare’s Othello. Each character displays a tragic flaw as the play unravels. The play would have no action without these tragic character flaws. Shakespeare provides these flaws to the characters to create dimension and suspense. Othello, Iago, Desdemona, and Emilia would be unrealistic, boring, and static characters without these flaws. The tragic flaw leads a character to downfall, and it is an integral part of a tragedy.

International Security: Saudi-Iraq Border Dispute Essay

When the Saudi Arabian government began to experience the uprising of social movements in the 1960s, one of the first suspects of origin was Baghdad. The tension that had been going on between the two countries quickly degenerated to a point where it became volatile. Since forces in Baghdad had been suspecting of having a role to play in movements similar to the one in Saudi Arabia around the same time, it was natural for Saudi Arabia to develop relations towards Baghdad that were all the more strained in nature. This paper shall provide an introduction to the relationship between Saudi Arabia and Iraq and shall attempt to begin by establishing an understanding of the evolution of their relationship over time in order to attain a clearer picture of attain a clear picture and a complete understanding of the actual nature of relationship that exists between the two countries. The paper shall begin by providing a brief introduction to the relationship between the two countries and shall then proceed to delve into the scenario that exists with respect to the volatility of the Saudi-Iraq border. The paper shall give special attention to areas that pertain to the terrorist threat posed because of the scenario that exists on the border of Saudi Arabia and Iraq. The paper will highlight the problem of the terrorist movement across the Saudi-Iraq border and shall elaborate upon the numerous aspects that pertain to the terrorist movement across the Saudi-Iraq border and how it serves to put both the countries at a risk in the process. In the latter paragraphs, the paper shall also elaborate upon the ethnic problems that exist in Iraq in order to highlight the volatile nature of the current Iraqi situation. Special consideration will be given to the aspect of migration that exists across the two regions and in the area of illegal migration with respect to situations such as the Saudi-Iraq border in general. As a result of the deteriorating relations with Iraq and the close proximity with the same that Saudi Arabia was faced with, it was only natural that Saudi Arabia began to attempt to strengthen its relationship with other neighboring countries and allies such as Iran, Kuwait, Syria and the United States. It is not too hard a task to note that Saudi Arabia was particular in improving relationships with countries that held a similar loathing towards the Iraqi government. The 1970s saw an improvement in the relations between Saudi Arabia and Iraq, fundamentally because of the fact that both countries were in fear of the implications of the Iranian Islamic Revolution spilling over into their territories. In the 1980s, Saudi Arabia actually served to assist Iraq during the Iran-Iraq war through numerous loans that were designed upon generous return terms (Tollitz, Prados and Blanchard). However, this ripening of the relationship between the two countries did not last long when Iraqi forces took hold of Kuwait. In retaliation, Saudi Arabia took action against Iraq and also sought assistance from the United States in confronting Iraqi forces. The United States responded by sending its troops to Saudi Arabia upon the invitation of the threatened country and using the coalition that they held in the opposition of Iraq, the United States forces were given complete permission to make use of Saudi Arabia’s military facilities. The United States did not merely assist the Saudi Arabia government in the war against Iraq but also served as an integral spearhead in the war. The United States forces were took part in ground assaults as well as areal assaults against Iraqi forces. The fact that the Iraqi forces chose to launch Scud-B missiles at numerous towns in the Saudi Arabia served to hit the nail on the head with regard to the deterioration of the relations between both countries. The damage to Saudi Arabia as a result of the missiles was predominantly that of civilian life and property. By this time, the relations between Iraq and Saudi Arabia damaged to a point where next to nothing could possibly be done to repair them since the people of the two countries had grown to loathe each other as the war raged on. As time went by after the war, every foreign policy that Saudi Arabia formulated was designed to ensure that it addressed any all threats that Iraq could pose towards Saudi Arabia. Elements such as these were areas of Saudi Arabia’s foreign policy which dictated that Saudi Arabia would support forces in Iraq that opposed the government and desired to remove Saddam Hussein’s reign (Al-Rasheed). The Saudi Arabia proceeded with this stance for a few years without making it too public, but as time went by and the 1990s approached, the desire to topple Saddam’s government became all the more dominant and prominent in Saudi Arabia’s foreign policy. When Saddam Hussein’s reign finally ended, Saudi Arabia was relieved of one issue with regard to Iraq, but was immediately visited by another. Over the years, the Saudi and the Iraqi border had been a much disputed region. Neutral zones had been established along the perimeter as a result of prolonged discussions and negotiations between the two countries. When the United States forces invaded Iraq, the influx of terrorists into Iraq and the out flux of refugees, both became functional in a manner such that the Iraq-Saudi Arabia border was incorporated (Tripp). It is essential to highlight at this point that in the latter half of 2006, it was reported that Al-Qaida operatives had begun to move from bases located and operational in the Pak-Afghan region, to Iraq where Al-Qaida has apparently decided to channel its man power for the coming period. It was speculated that there is a chance that Al-Qaida operatives may choose to enter Saudi Arabia and then gain access to Iraq through the border connecting Saudi Arabia and Iraq. It would not be unjustified to concur that Iraq is playing out the role of a magnet of sorts for hostile elements such as Al-Qaida and regions that fall around Iraq are therefore falling into the line of fire (Regan). As Al-Qaida operatives move from around the world towards the Middle East, Saudi Arabia is faced with a security threat that makes it not only vulnerable to terrorist threats, but by serving as a pathway for terrorist elements to cross through into Iraq, also puts Saudi Arabia in a compromising position with regard to its role in preserving international peace. The scenario for Saudi Arabia is quite similar to that which exists for the United States with regard to Mexico and for Israel with regard to Palestinian areas. Much like the United States, Saudi Arabia is also considering establishing a barrier along its borders. The Saudi Arabia is considering serious plans to establish a penetration proof barrier along its border with Iraq in order to keep out any violent and hostile elements. Not only are political extremists an issue, but the supplementing threat of drug smugglers does not come as any improvement in the scenario because this serves to open routes for other unwanted parties such as weapons dealers and human smugglers. The involvement of elements such as these causes the further degradation of the scenario and puts Saudi Arabia at a high security risk level. The threat to Saudi Arabia has only increased with the recent war in Iraq that has caused countless Iraqis to opt to flee across the Iraq-Saudi Arabia border. Along with the few refugees that have attempted to do so, hostile elements have also attempted to take advantage of the chaotic situation and have tried to gain access to Saudi Arabia. Saudi Arabia faces a highly vulnerable standing because of its border disputes with Iraq because of the fact that the Shia minorities of the country are located in the most significant oil producing regions of the country (The Associated Press ). However, the border is not causing problems merely for Saudi Arabia, but is also causing problems on the other side of the fence. This is because of the fact that as the war in Iraq rages on, hostile elements from Saudi Arabia are choosing to cross the border and join terrorists groups in Iraq that are operating against the coalition forces. The situation worsens further with the fact that this puts Saudi Arabia in a position where it may possibly serve as a gateway for terrorists into Iraqi territory. It has become almost natural for the neighboring countries of Iraq to fear that the force with which coalition forces are carrying out operations in Iraq may cause hostile elements to opt for using Iraq’s neighboring countries as their bases of operations or as safe houses for refuge (Saudi-US Relations Information Service). It is for the same reason that Saudi Arabia has decided to undertake security projects along its borders with Iraq that ensure that there will be almost no possibility of any infiltration from any of the two sides of the border. Measures such as these are because of the fact that the frequent illegal movement of hostile elements and illegal immigrants across the border tends to encourage such elements to attempt to transport equipment across the border as well. In the case of terrorist elements, this aspect is nothing less than alarming considering the damage that terrorists groups can cause to Saudi Arabia and Iraq both if they managed to establish a pathway to transport heavy weapons to and from the two countries. Because of the presence of such multilateral threats, both the Saudi Arabia and the Iraqi government have attempted to reconcile on disputes that they previously did not choose to bring up (Saudi-US Relations Information Service). Another adverse implication of the existence of the cross-border movement dispute between the two countries is the fact that there is a possibility that the excessive movement of hostile elements from Iraq may encourage elements to move across the border that could instigate the Shia minority into getting carried away with their emotions and working against the coalition forces (The Associated Press ). Iraq has been plagues with ethnic problems for years now. The conflicts between Sunnis and Shiite Arabs have turned Iraq into an increasingly volatile battle ground. Under the dictatorship of Saddam Hussein, the Shiites grew exponentially powerful and reached a point in the Iraqi society where they constituted sixty percent of the Iraqi society and were still denied their fundamental political and religious rights. Under Saddam Hussein’s regime, the Sunnis gained more power and reached a point where they formed the bulk of Saddam’s administration. A fact that serves to irk the Sunni population of Iraq is the presence of the political ties with Iran. This serves to anger not only the Sunnis of Iraq but also the Arab countries that are United States allies. The fear of Iranian influences intervening in the already increasingly volatile Iraqi scenario is an aspect that serves to increase doubts about the prospective Iraqi scenario. However, it is essential to mention that Kurds also play a significant role in the Iraqi scenario since they comprise of nearly twenty percent of the total Iraqi population. This puts them in a position where they are a minority that can have a significant influence upon the series of events that Iraq undergoes. The Kurds have their own distinct language, culture, history and traditions and are generally concentrated in and around the northern areas of Iraq. The Kurds have been struggling for their rights in the regions of northern Iraq, eastern Turkey, northeastern Syria, northern Iran and southern Georgia. Incidents where the Kurds have chosen to initiate a movement and have been faced with vicious oppression from the resident society. However, since the gulf war in 1991, the Kurds have found a considerable degree of independence in the regions in and around northern Iraq and have entered into Iraqi politics as well. However, even though the Kurds have gained a significant degree of recognition in Iraq, their desire to gain independence still exists with the same vigor as it held several decades ago. Fundamentally, the Kurds are a part of the Sunni Muslim population of Iraq, but the aspect of secular nationalism is quite strong in them. Another fact which serves to make the Kurds a highly crucial element in the Iraqi scenario is that they are concentrated in the northern regions of Iraq where oil is found quite commonly (Karon). This puts the Kurds in a position where they can choose to keep revenues with themselves instead of handing them over to the state, hence enabling them to establish an autonomous government that they can protect it from an external intrusion. However, the Kurds are faced with opposition from not only the powers of the state but also from the Turkmen minority that also has the same intentions. There has been a vast amount of migration in the Arabic gulf countries and specially the United Arab Emirates and if one was to consider the aspect of the migration that is caused as a result of disputes such as the Saudi-Iraq border issue, there are a number of natures of immigrants that can move about. The first and most dangerous are the terrorist elements that more than often choose to move around when disputes such as the Iraq-United States war erupt. When terrorist elements move around, they tend to establish a base of operations in any region they can during their stay there. Their movement causes the exercising of terrorist elements that may otherwise have become stationary and of no threat to the region where they are concealing themselves. As a result of the movement of active terrorist elements, these otherwise stationary terrorist elements become an active threat to the immediate region and the exchanging of information amongst these elements serves to increase the danger of the execution of a terrorist activity exponentially. This is also associated with the fact that the continuous movements of terrorists across different regions causes them to form safe houses in these regions that can later turn into their base of operations. Therefore, a country that is housing an active terrorism element may be actually serving as a base of operations for a terrorist activity in another country. The presence of scenarios such as these serves to cause deterioration of the relationship amongst allies because of the fact that evidence found at a terrorist attack which directs towards the involvement of an ally country serves to decrease the degree of trust that the victim region has on its ally and also simultaneously serves to show the inability of the region in keeping terrorist elements out or handling them once they have gained access, causing a deterioration in overall international relations. The second form of immigrants in a scenario such as this include refugees who choose to leave behind their native land and attempt to establish a refuge in a region that is not their native region by birth. In cases such as these, the region to which they migrate in order to seek refuge more than often has to face an imbalance of sorts because of the adjustment of an unexpected influx of refugees into the region. In cases where the region is already suffering through an economic imbalance, the influx of refugees causes a further deterioration of the economic scenario.